Review





Similar Products

94
Miltenyi Biotec icam
Icam, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+icam+2/CD102+(ICAM-2)+Antibody%2C+anti-human%2C+REAfinity/pm41834645-59-53-54
Average 94 stars, based on 1 article reviews
icam - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc cd102 icam 2 rabbit mab
Cd102 Icam 2 Rabbit Mab, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+icam+2/CD102%2FICAM-2+Rabbit+mAb/bio_rxiv__64898__2026__01__19__699861-207-16-21
Average 93 stars, based on 1 article reviews
cd102 icam 2 rabbit mab - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Boster Bio anti icam 1 antibody
Anti Icam 1 Antibody, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+icam+2/Anti-Hu+CD54+Purified+ICAM1+Monoclonal+Antibody/10__1016_slash_j__bioadv__2026__214703-60-7-11
Average 93 stars, based on 1 article reviews
anti icam 1 antibody - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Miltenyi Biotec icam2
<t>ICAM2</t> localization in rat dental pulp tissue and ICAM2 expression in HDPCs. ( A ) The mRNA expression of ICAM1 , ICAM2 (black column), ICAM3 , ICAM4 , ICAM5 in HDPC-5Y was assessed by quantitative RT-PCR (qRT-PCR). It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01). ( B ) Hematoxylin-eosin (H&E) staining of tissue sections (sagittal sections) of mandibular first molars from Wistar rats. The right panel is the higher magnification view of boxed area in the left panel. PU: dental pulp tissue; De: Dentin. Bars, 100 μm. ( C – E ) Immunofluorescence (IF) staining of ICAM2 in the normal dental pulp tissue ( C ). The higher magnification view of boxed area in ( C , D ). Positive staining was indicated by arrow heads (odontoblasts) and arrow (dental pulp cells). Negative control: rabbit IgG (cIgG; ( E )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( F , G ) The expression of ICAM2 in HDPC-5Y was examined by IF staining. Anti-ICAM2: Green ( F ), anti-rabbit IgG (control IgG: cIgG; ( G )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. Arrow heads indicate ICAM2-positive HDPCs ( F ). ( H ) The gene expression of ICAM2 in three HDPCs (HDPC-5Y, 5L, and 5I) was examined by semi-qRT-PCR. It was normalized against GAPDH expression. ( I ) The expression intensities of ICAM2 (CD102) of HDPC-5Y (orange line) were demonstrated by flow cytometry. In the gated region, positive cells. Gray line indicates negative control (rabbit IgG).
Icam2, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+icam+2/CD102+(ICAM-2)+Antibody%2C+anti-mouse%2C+REAfinity/pmc12732756-165-4-17
Average 93 stars, based on 1 article reviews
icam2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Miltenyi Biotec bead conjugated antibody against cd102
<t>ICAM2</t> localization in rat dental pulp tissue and ICAM2 expression in HDPCs. ( A ) The mRNA expression of ICAM1 , ICAM2 (black column), ICAM3 , ICAM4 , ICAM5 in HDPC-5Y was assessed by quantitative RT-PCR (qRT-PCR). It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01). ( B ) Hematoxylin-eosin (H&E) staining of tissue sections (sagittal sections) of mandibular first molars from Wistar rats. The right panel is the higher magnification view of boxed area in the left panel. PU: dental pulp tissue; De: Dentin. Bars, 100 μm. ( C – E ) Immunofluorescence (IF) staining of ICAM2 in the normal dental pulp tissue ( C ). The higher magnification view of boxed area in ( C , D ). Positive staining was indicated by arrow heads (odontoblasts) and arrow (dental pulp cells). Negative control: rabbit IgG (cIgG; ( E )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( F , G ) The expression of ICAM2 in HDPC-5Y was examined by IF staining. Anti-ICAM2: Green ( F ), anti-rabbit IgG (control IgG: cIgG; ( G )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. Arrow heads indicate ICAM2-positive HDPCs ( F ). ( H ) The gene expression of ICAM2 in three HDPCs (HDPC-5Y, 5L, and 5I) was examined by semi-qRT-PCR. It was normalized against GAPDH expression. ( I ) The expression intensities of ICAM2 <t>(CD102)</t> of HDPC-5Y (orange line) were demonstrated by flow cytometry. In the gated region, positive cells. Gray line indicates negative control (rabbit IgG).
Bead Conjugated Antibody Against Cd102, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+icam+2/CD102+(ICAM-2)+Antibody%2C+anti-mouse%2C+REAfinity/pmc12732756-165-12-17
Average 93 stars, based on 1 article reviews
bead conjugated antibody against cd102 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Boster Bio icam 1
<t>ICAM2</t> localization in rat dental pulp tissue and ICAM2 expression in HDPCs. ( A ) The mRNA expression of ICAM1 , ICAM2 (black column), ICAM3 , ICAM4 , ICAM5 in HDPC-5Y was assessed by quantitative RT-PCR (qRT-PCR). It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01). ( B ) Hematoxylin-eosin (H&E) staining of tissue sections (sagittal sections) of mandibular first molars from Wistar rats. The right panel is the higher magnification view of boxed area in the left panel. PU: dental pulp tissue; De: Dentin. Bars, 100 μm. ( C – E ) Immunofluorescence (IF) staining of ICAM2 in the normal dental pulp tissue ( C ). The higher magnification view of boxed area in ( C , D ). Positive staining was indicated by arrow heads (odontoblasts) and arrow (dental pulp cells). Negative control: rabbit IgG (cIgG; ( E )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( F , G ) The expression of ICAM2 in HDPC-5Y was examined by IF staining. Anti-ICAM2: Green ( F ), anti-rabbit IgG (control IgG: cIgG; ( G )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. Arrow heads indicate ICAM2-positive HDPCs ( F ). ( H ) The gene expression of ICAM2 in three HDPCs (HDPC-5Y, 5L, and 5I) was examined by semi-qRT-PCR. It was normalized against GAPDH expression. ( I ) The expression intensities of ICAM2 <t>(CD102)</t> of HDPC-5Y (orange line) were demonstrated by flow cytometry. In the gated region, positive cells. Gray line indicates negative control (rabbit IgG).
Icam 1, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+icam+2/Anti-Hu+CD54+Purified+ICAM1+Monoclonal+Antibody/pmc12289127-3-0-2
Average 93 stars, based on 1 article reviews
icam 1 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology mouse anti human icam 1 15 2 monoclonal
<t>ICAM2</t> localization in rat dental pulp tissue and ICAM2 expression in HDPCs. ( A ) The mRNA expression of ICAM1 , ICAM2 (black column), ICAM3 , ICAM4 , ICAM5 in HDPC-5Y was assessed by quantitative RT-PCR (qRT-PCR). It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01). ( B ) Hematoxylin-eosin (H&E) staining of tissue sections (sagittal sections) of mandibular first molars from Wistar rats. The right panel is the higher magnification view of boxed area in the left panel. PU: dental pulp tissue; De: Dentin. Bars, 100 μm. ( C – E ) Immunofluorescence (IF) staining of ICAM2 in the normal dental pulp tissue ( C ). The higher magnification view of boxed area in ( C , D ). Positive staining was indicated by arrow heads (odontoblasts) and arrow (dental pulp cells). Negative control: rabbit IgG (cIgG; ( E )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( F , G ) The expression of ICAM2 in HDPC-5Y was examined by IF staining. Anti-ICAM2: Green ( F ), anti-rabbit IgG (control IgG: cIgG; ( G )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. Arrow heads indicate ICAM2-positive HDPCs ( F ). ( H ) The gene expression of ICAM2 in three HDPCs (HDPC-5Y, 5L, and 5I) was examined by semi-qRT-PCR. It was normalized against GAPDH expression. ( I ) The expression intensities of ICAM2 <t>(CD102)</t> of HDPC-5Y (orange line) were demonstrated by flow cytometry. In the gated region, positive cells. Gray line indicates negative control (rabbit IgG).
Mouse Anti Human Icam 1 15 2 Monoclonal, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+icam+2/ICAM-1+Antibody/pmc12304941-8-0-9
Average 96 stars, based on 1 article reviews
mouse anti human icam 1 15 2 monoclonal - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology cd102
<t>ICAM2</t> localization in rat dental pulp tissue and ICAM2 expression in HDPCs. ( A ) The mRNA expression of ICAM1 , ICAM2 (black column), ICAM3 , ICAM4 , ICAM5 in HDPC-5Y was assessed by quantitative RT-PCR (qRT-PCR). It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01). ( B ) Hematoxylin-eosin (H&E) staining of tissue sections (sagittal sections) of mandibular first molars from Wistar rats. The right panel is the higher magnification view of boxed area in the left panel. PU: dental pulp tissue; De: Dentin. Bars, 100 μm. ( C – E ) Immunofluorescence (IF) staining of ICAM2 in the normal dental pulp tissue ( C ). The higher magnification view of boxed area in ( C , D ). Positive staining was indicated by arrow heads (odontoblasts) and arrow (dental pulp cells). Negative control: rabbit IgG (cIgG; ( E )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( F , G ) The expression of ICAM2 in HDPC-5Y was examined by IF staining. Anti-ICAM2: Green ( F ), anti-rabbit IgG (control IgG: cIgG; ( G )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. Arrow heads indicate ICAM2-positive HDPCs ( F ). ( H ) The gene expression of ICAM2 in three HDPCs (HDPC-5Y, 5L, and 5I) was examined by semi-qRT-PCR. It was normalized against GAPDH expression. ( I ) The expression intensities of ICAM2 <t>(CD102)</t> of HDPC-5Y (orange line) were demonstrated by flow cytometry. In the gated region, positive cells. Gray line indicates negative control (rabbit IgG).
Cd102, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+icam+2/ICAM-2+Antibody/10__1016_slash_j__matdes__2025__114453-138-11-12
Average 93 stars, based on 1 article reviews
cd102 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Boster Bio factor tggacgcacagaacagtctc cctccagggctcacaataaa nm 000757 4 icam
<t>ICAM2</t> localization in rat dental pulp tissue and ICAM2 expression in HDPCs. ( A ) The mRNA expression of ICAM1 , ICAM2 (black column), ICAM3 , ICAM4 , ICAM5 in HDPC-5Y was assessed by quantitative RT-PCR (qRT-PCR). It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01). ( B ) Hematoxylin-eosin (H&E) staining of tissue sections (sagittal sections) of mandibular first molars from Wistar rats. The right panel is the higher magnification view of boxed area in the left panel. PU: dental pulp tissue; De: Dentin. Bars, 100 μm. ( C – E ) Immunofluorescence (IF) staining of ICAM2 in the normal dental pulp tissue ( C ). The higher magnification view of boxed area in ( C , D ). Positive staining was indicated by arrow heads (odontoblasts) and arrow (dental pulp cells). Negative control: rabbit IgG (cIgG; ( E )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( F , G ) The expression of ICAM2 in HDPC-5Y was examined by IF staining. Anti-ICAM2: Green ( F ), anti-rabbit IgG (control IgG: cIgG; ( G )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. Arrow heads indicate ICAM2-positive HDPCs ( F ). ( H ) The gene expression of ICAM2 in three HDPCs (HDPC-5Y, 5L, and 5I) was examined by semi-qRT-PCR. It was normalized against GAPDH expression. ( I ) The expression intensities of ICAM2 <t>(CD102)</t> of HDPC-5Y (orange line) were demonstrated by flow cytometry. In the gated region, positive cells. Gray line indicates negative control (rabbit IgG).
Factor Tggacgcacagaacagtctc Cctccagggctcacaataaa Nm 000757 4 Icam, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+icam+2/Anti-Hu+CD54+Purified+ICAM1+Monoclonal+Antibody/pm40377300-87-45-75
Average 93 stars, based on 1 article reviews
factor tggacgcacagaacagtctc cctccagggctcacaataaa nm 000757 4 icam - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc icam 1
<t>ICAM2</t> localization in rat dental pulp tissue and ICAM2 expression in HDPCs. ( A ) The mRNA expression of ICAM1 , ICAM2 (black column), ICAM3 , ICAM4 , ICAM5 in HDPC-5Y was assessed by quantitative RT-PCR (qRT-PCR). It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01). ( B ) Hematoxylin-eosin (H&E) staining of tissue sections (sagittal sections) of mandibular first molars from Wistar rats. The right panel is the higher magnification view of boxed area in the left panel. PU: dental pulp tissue; De: Dentin. Bars, 100 μm. ( C – E ) Immunofluorescence (IF) staining of ICAM2 in the normal dental pulp tissue ( C ). The higher magnification view of boxed area in ( C , D ). Positive staining was indicated by arrow heads (odontoblasts) and arrow (dental pulp cells). Negative control: rabbit IgG (cIgG; ( E )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( F , G ) The expression of ICAM2 in HDPC-5Y was examined by IF staining. Anti-ICAM2: Green ( F ), anti-rabbit IgG (control IgG: cIgG; ( G )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. Arrow heads indicate ICAM2-positive HDPCs ( F ). ( H ) The gene expression of ICAM2 in three HDPCs (HDPC-5Y, 5L, and 5I) was examined by semi-qRT-PCR. It was normalized against GAPDH expression. ( I ) The expression intensities of ICAM2 <t>(CD102)</t> of HDPC-5Y (orange line) were demonstrated by flow cytometry. In the gated region, positive cells. Gray line indicates negative control (rabbit IgG).
Icam 1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+icam+2/IFN-gamma+(XMG1%2E2)+Rat+mAb/pm40210127-70-5-40
Average 93 stars, based on 1 article reviews
icam 1 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


ICAM2 localization in rat dental pulp tissue and ICAM2 expression in HDPCs. ( A ) The mRNA expression of ICAM1 , ICAM2 (black column), ICAM3 , ICAM4 , ICAM5 in HDPC-5Y was assessed by quantitative RT-PCR (qRT-PCR). It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01). ( B ) Hematoxylin-eosin (H&E) staining of tissue sections (sagittal sections) of mandibular first molars from Wistar rats. The right panel is the higher magnification view of boxed area in the left panel. PU: dental pulp tissue; De: Dentin. Bars, 100 μm. ( C – E ) Immunofluorescence (IF) staining of ICAM2 in the normal dental pulp tissue ( C ). The higher magnification view of boxed area in ( C , D ). Positive staining was indicated by arrow heads (odontoblasts) and arrow (dental pulp cells). Negative control: rabbit IgG (cIgG; ( E )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( F , G ) The expression of ICAM2 in HDPC-5Y was examined by IF staining. Anti-ICAM2: Green ( F ), anti-rabbit IgG (control IgG: cIgG; ( G )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. Arrow heads indicate ICAM2-positive HDPCs ( F ). ( H ) The gene expression of ICAM2 in three HDPCs (HDPC-5Y, 5L, and 5I) was examined by semi-qRT-PCR. It was normalized against GAPDH expression. ( I ) The expression intensities of ICAM2 (CD102) of HDPC-5Y (orange line) were demonstrated by flow cytometry. In the gated region, positive cells. Gray line indicates negative control (rabbit IgG).

Journal: International Journal of Molecular Sciences

Article Title: The Function and Role of Intercellular Adhesion Molecule 2 in Dental Pulp Cells and Tissue

doi: 10.3390/ijms262412006

Figure Lengend Snippet: ICAM2 localization in rat dental pulp tissue and ICAM2 expression in HDPCs. ( A ) The mRNA expression of ICAM1 , ICAM2 (black column), ICAM3 , ICAM4 , ICAM5 in HDPC-5Y was assessed by quantitative RT-PCR (qRT-PCR). It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01). ( B ) Hematoxylin-eosin (H&E) staining of tissue sections (sagittal sections) of mandibular first molars from Wistar rats. The right panel is the higher magnification view of boxed area in the left panel. PU: dental pulp tissue; De: Dentin. Bars, 100 μm. ( C – E ) Immunofluorescence (IF) staining of ICAM2 in the normal dental pulp tissue ( C ). The higher magnification view of boxed area in ( C , D ). Positive staining was indicated by arrow heads (odontoblasts) and arrow (dental pulp cells). Negative control: rabbit IgG (cIgG; ( E )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( F , G ) The expression of ICAM2 in HDPC-5Y was examined by IF staining. Anti-ICAM2: Green ( F ), anti-rabbit IgG (control IgG: cIgG; ( G )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. Arrow heads indicate ICAM2-positive HDPCs ( F ). ( H ) The gene expression of ICAM2 in three HDPCs (HDPC-5Y, 5L, and 5I) was examined by semi-qRT-PCR. It was normalized against GAPDH expression. ( I ) The expression intensities of ICAM2 (CD102) of HDPC-5Y (orange line) were demonstrated by flow cytometry. In the gated region, positive cells. Gray line indicates negative control (rabbit IgG).

Article Snippet: HDPCs were separated into ICAM2-positive and ICAM2-negative HDPCs by MACS using a bead-conjugated antibody against CD102 (ICAM2; Miltenyi Biotec, Bergisch Gladbach, Germany) in accordance with the manufacturer’s instructions.

Techniques: Expressing, Quantitative RT-PCR, Staining, Immunofluorescence, Negative Control, Control, Gene Expression, Flow Cytometry

ICAM2 expression in rat dental pulp tissue after direct pulp capping. ( A , B ) H&E staining of the rat dental pulp tissue after 7 days of treatment. ( B ) Higher magnification views of the boxed area in ( A ). DP: dental pulp tissue; DE: dentin; Arrowhead: reparative dentin. Bars, 100 μm. ( C – I ) IF staining of ICAM2 in the normal dental pulp tissue ( C ) and dental pulp tissue at 1 ( D ), 3 ( E ), 5 ( F ), 7 ( G ), and 14 days ( H ) post-direct pulp capping operation. Anti-ICAM2 (Green); Nuclei were stained with DAPI (Blue). Bars, 100 μm. Arrow heads indicate ICAM2-positive cells ( E ). ( I ) The number of ICAM2-positive DPCs was quantified (means ± SD; n = 3; ** p < 0.01).

Journal: International Journal of Molecular Sciences

Article Title: The Function and Role of Intercellular Adhesion Molecule 2 in Dental Pulp Cells and Tissue

doi: 10.3390/ijms262412006

Figure Lengend Snippet: ICAM2 expression in rat dental pulp tissue after direct pulp capping. ( A , B ) H&E staining of the rat dental pulp tissue after 7 days of treatment. ( B ) Higher magnification views of the boxed area in ( A ). DP: dental pulp tissue; DE: dentin; Arrowhead: reparative dentin. Bars, 100 μm. ( C – I ) IF staining of ICAM2 in the normal dental pulp tissue ( C ) and dental pulp tissue at 1 ( D ), 3 ( E ), 5 ( F ), 7 ( G ), and 14 days ( H ) post-direct pulp capping operation. Anti-ICAM2 (Green); Nuclei were stained with DAPI (Blue). Bars, 100 μm. Arrow heads indicate ICAM2-positive cells ( E ). ( I ) The number of ICAM2-positive DPCs was quantified (means ± SD; n = 3; ** p < 0.01).

Article Snippet: HDPCs were separated into ICAM2-positive and ICAM2-negative HDPCs by MACS using a bead-conjugated antibody against CD102 (ICAM2; Miltenyi Biotec, Bergisch Gladbach, Germany) in accordance with the manufacturer’s instructions.

Techniques: Expressing, Staining

Effect of ICAM2 knockdown on odontoblast-like differentiation of HDPCs. ( A ) The expression of ICAM2 mRNA in HDPC-5Y transfected with negative control siRNA (siCont.) or ICAM2 siRNA (siICAM2) was assessed by qRT-PCR (UT, Untreated; means ± SD; n = 4; ** p < 0.01). ( B ) The expression of ICAM2 in HDPC-5Y was examined by IF staining. Anti-ICAM2: Green; Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( C , D ) The formation of mineralized nodules in HDPC-5Y transfected with siCont or siICAM2 was examined by alizarin red S (ARS) staining after culture in odontoblast-like differentiation medium (DM) for 3 weeks. n = 3. The bar, 5 mm. ( D ) The graph shows quantitative analysis of the area of each ARS-positive region, which was imaged and measured using a Biozero digital microscope (means ± SD; n = 3; ** p < 0.01). ( E ) The gene expression of DSPP , Nestin , TH, and OPN in HDPC-5Y transfected with siCont or siICAM2, which were cultured with DM for 7 days, was assessed by qRT-PCR. It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01, * p < 0.05).

Journal: International Journal of Molecular Sciences

Article Title: The Function and Role of Intercellular Adhesion Molecule 2 in Dental Pulp Cells and Tissue

doi: 10.3390/ijms262412006

Figure Lengend Snippet: Effect of ICAM2 knockdown on odontoblast-like differentiation of HDPCs. ( A ) The expression of ICAM2 mRNA in HDPC-5Y transfected with negative control siRNA (siCont.) or ICAM2 siRNA (siICAM2) was assessed by qRT-PCR (UT, Untreated; means ± SD; n = 4; ** p < 0.01). ( B ) The expression of ICAM2 in HDPC-5Y was examined by IF staining. Anti-ICAM2: Green; Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( C , D ) The formation of mineralized nodules in HDPC-5Y transfected with siCont or siICAM2 was examined by alizarin red S (ARS) staining after culture in odontoblast-like differentiation medium (DM) for 3 weeks. n = 3. The bar, 5 mm. ( D ) The graph shows quantitative analysis of the area of each ARS-positive region, which was imaged and measured using a Biozero digital microscope (means ± SD; n = 3; ** p < 0.01). ( E ) The gene expression of DSPP , Nestin , TH, and OPN in HDPC-5Y transfected with siCont or siICAM2, which were cultured with DM for 7 days, was assessed by qRT-PCR. It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01, * p < 0.05).

Article Snippet: HDPCs were separated into ICAM2-positive and ICAM2-negative HDPCs by MACS using a bead-conjugated antibody against CD102 (ICAM2; Miltenyi Biotec, Bergisch Gladbach, Germany) in accordance with the manufacturer’s instructions.

Techniques: Knockdown, Expressing, Transfection, Negative Control, Quantitative RT-PCR, Staining, Microscopy, Gene Expression, Cell Culture

Effect of ICAM2-expressing HDPCs on odontoblast-like differentiation. ( A ) Schema of HDPCs separated using magnetic cell sorting (MACS) and the culture supernatants of each separated cell collected. ( B ) The gene expression of ICAM2 in ICAM2-negative HDPCs (ICAM2(−) HDPCs) and ICAM2-positive HDPCs (ICAM2(+) HDPCs) after separation using MACS was assessed by quantitative RT-PCR. It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01). ( C ) The expression of ICAM2 in HDPC-5Y was examined by immunofluorescence staining. Anti-ICAM2: Green; Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( D ) The formation of mineralized nodules in HDPC-5Y was examined by ARS staining after culture in DM with ICAM2(−) HDPCs or ICAM2(+) HDPCs supernatant for 3 weeks. n = 3. The bar, 5 mm. ( E ) The graph shows quantitative analysis of the area of each ARS-positive region, which was imaged and measured using a Biozero digital microscope (means ± SD; n = 3; ** p < 0.01). ( F , G ) The gene expression of odontoblast-related markers ( DSPP , Nestin , TH and OPN ) ( F ) and mineralization-inhibitory factors ( βig-h3 and Wnt5a ) ( G ) in ICAM2(−) HDPCs and ICAM2(+) HDPCs were assessed by quantitative RT-PCR. It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01, * p < 0.05). ( H ) The concentration of secreted Wnt5a protein in ICAM2(−) HDPCs and ICAM2(+) HDPCs supernatant was determined by ELISA.

Journal: International Journal of Molecular Sciences

Article Title: The Function and Role of Intercellular Adhesion Molecule 2 in Dental Pulp Cells and Tissue

doi: 10.3390/ijms262412006

Figure Lengend Snippet: Effect of ICAM2-expressing HDPCs on odontoblast-like differentiation. ( A ) Schema of HDPCs separated using magnetic cell sorting (MACS) and the culture supernatants of each separated cell collected. ( B ) The gene expression of ICAM2 in ICAM2-negative HDPCs (ICAM2(−) HDPCs) and ICAM2-positive HDPCs (ICAM2(+) HDPCs) after separation using MACS was assessed by quantitative RT-PCR. It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01). ( C ) The expression of ICAM2 in HDPC-5Y was examined by immunofluorescence staining. Anti-ICAM2: Green; Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( D ) The formation of mineralized nodules in HDPC-5Y was examined by ARS staining after culture in DM with ICAM2(−) HDPCs or ICAM2(+) HDPCs supernatant for 3 weeks. n = 3. The bar, 5 mm. ( E ) The graph shows quantitative analysis of the area of each ARS-positive region, which was imaged and measured using a Biozero digital microscope (means ± SD; n = 3; ** p < 0.01). ( F , G ) The gene expression of odontoblast-related markers ( DSPP , Nestin , TH and OPN ) ( F ) and mineralization-inhibitory factors ( βig-h3 and Wnt5a ) ( G ) in ICAM2(−) HDPCs and ICAM2(+) HDPCs were assessed by quantitative RT-PCR. It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01, * p < 0.05). ( H ) The concentration of secreted Wnt5a protein in ICAM2(−) HDPCs and ICAM2(+) HDPCs supernatant was determined by ELISA.

Article Snippet: HDPCs were separated into ICAM2-positive and ICAM2-negative HDPCs by MACS using a bead-conjugated antibody against CD102 (ICAM2; Miltenyi Biotec, Bergisch Gladbach, Germany) in accordance with the manufacturer’s instructions.

Techniques: Expressing, FACS, Gene Expression, Quantitative RT-PCR, Immunofluorescence, Staining, Microscopy, Concentration Assay, Enzyme-linked Immunosorbent Assay

Schematic diagram suggesting the process of reparative dentin formation after direct pulp capping. By the 3 days after direct pulp capping, ICAM2-positive DPCs increased near the pulp capping area, and the mineralization-inhibitory factors secreted by these cells may have suppressed the differentiation of DPCs into odontoblast-like cells. This action may prevent excessive reparative dentin formation after direct pulp capping, restoring dental pulp tissue homeostasis. The dashed box area in the upper left figure indicates the direct pulp capping area (other five figures).

Journal: International Journal of Molecular Sciences

Article Title: The Function and Role of Intercellular Adhesion Molecule 2 in Dental Pulp Cells and Tissue

doi: 10.3390/ijms262412006

Figure Lengend Snippet: Schematic diagram suggesting the process of reparative dentin formation after direct pulp capping. By the 3 days after direct pulp capping, ICAM2-positive DPCs increased near the pulp capping area, and the mineralization-inhibitory factors secreted by these cells may have suppressed the differentiation of DPCs into odontoblast-like cells. This action may prevent excessive reparative dentin formation after direct pulp capping, restoring dental pulp tissue homeostasis. The dashed box area in the upper left figure indicates the direct pulp capping area (other five figures).

Article Snippet: HDPCs were separated into ICAM2-positive and ICAM2-negative HDPCs by MACS using a bead-conjugated antibody against CD102 (ICAM2; Miltenyi Biotec, Bergisch Gladbach, Germany) in accordance with the manufacturer’s instructions.

Techniques:

ICAM2 localization in rat dental pulp tissue and ICAM2 expression in HDPCs. ( A ) The mRNA expression of ICAM1 , ICAM2 (black column), ICAM3 , ICAM4 , ICAM5 in HDPC-5Y was assessed by quantitative RT-PCR (qRT-PCR). It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01). ( B ) Hematoxylin-eosin (H&E) staining of tissue sections (sagittal sections) of mandibular first molars from Wistar rats. The right panel is the higher magnification view of boxed area in the left panel. PU: dental pulp tissue; De: Dentin. Bars, 100 μm. ( C – E ) Immunofluorescence (IF) staining of ICAM2 in the normal dental pulp tissue ( C ). The higher magnification view of boxed area in ( C , D ). Positive staining was indicated by arrow heads (odontoblasts) and arrow (dental pulp cells). Negative control: rabbit IgG (cIgG; ( E )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( F , G ) The expression of ICAM2 in HDPC-5Y was examined by IF staining. Anti-ICAM2: Green ( F ), anti-rabbit IgG (control IgG: cIgG; ( G )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. Arrow heads indicate ICAM2-positive HDPCs ( F ). ( H ) The gene expression of ICAM2 in three HDPCs (HDPC-5Y, 5L, and 5I) was examined by semi-qRT-PCR. It was normalized against GAPDH expression. ( I ) The expression intensities of ICAM2 (CD102) of HDPC-5Y (orange line) were demonstrated by flow cytometry. In the gated region, positive cells. Gray line indicates negative control (rabbit IgG).

Journal: International Journal of Molecular Sciences

Article Title: The Function and Role of Intercellular Adhesion Molecule 2 in Dental Pulp Cells and Tissue

doi: 10.3390/ijms262412006

Figure Lengend Snippet: ICAM2 localization in rat dental pulp tissue and ICAM2 expression in HDPCs. ( A ) The mRNA expression of ICAM1 , ICAM2 (black column), ICAM3 , ICAM4 , ICAM5 in HDPC-5Y was assessed by quantitative RT-PCR (qRT-PCR). It was normalized against β-actin expression (means ± SD; n = 4; ** p < 0.01). ( B ) Hematoxylin-eosin (H&E) staining of tissue sections (sagittal sections) of mandibular first molars from Wistar rats. The right panel is the higher magnification view of boxed area in the left panel. PU: dental pulp tissue; De: Dentin. Bars, 100 μm. ( C – E ) Immunofluorescence (IF) staining of ICAM2 in the normal dental pulp tissue ( C ). The higher magnification view of boxed area in ( C , D ). Positive staining was indicated by arrow heads (odontoblasts) and arrow (dental pulp cells). Negative control: rabbit IgG (cIgG; ( E )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. ( F , G ) The expression of ICAM2 in HDPC-5Y was examined by IF staining. Anti-ICAM2: Green ( F ), anti-rabbit IgG (control IgG: cIgG; ( G )). Nuclei were stained with DAPI (Blue). Bars, 100 μm. Arrow heads indicate ICAM2-positive HDPCs ( F ). ( H ) The gene expression of ICAM2 in three HDPCs (HDPC-5Y, 5L, and 5I) was examined by semi-qRT-PCR. It was normalized against GAPDH expression. ( I ) The expression intensities of ICAM2 (CD102) of HDPC-5Y (orange line) were demonstrated by flow cytometry. In the gated region, positive cells. Gray line indicates negative control (rabbit IgG).

Article Snippet: HDPCs were separated into ICAM2-positive and ICAM2-negative HDPCs by MACS using a bead-conjugated antibody against CD102 (ICAM2; Miltenyi Biotec, Bergisch Gladbach, Germany) in accordance with the manufacturer’s instructions.

Techniques: Expressing, Quantitative RT-PCR, Staining, Immunofluorescence, Negative Control, Control, Gene Expression, Flow Cytometry